 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| CircPSMC3 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
| DBLink | Link to database | PMID | 31726810 |
| Experimental Method | |||
| Sample Type | Tissues, cell lines and blood sample | Comparison | One hundred and-six samples of GC tissues were matched to adjacent normal tissues and 10 ml preoperative blood venous blood were collected |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GTTTAGGGTCCCTGCCCTTTG ReverseGTGTTGGGCTGGAAGCCATC | Statistics | Fold Change : Downregulated pvalue : <0.05 |
| Citation | |||
| Tang, B, Wang, Y, Zhu, F, Li, H, Liu, L, Chen, Y, Zhou, Y (2019). Circular circPSMC3 inhibits hepatocellular carcinoma migration and invasion by upregulating RBM5. Minerva Med., :no page given. | |||